biotinylated form Search Results


90
Promega 59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39)
59 Biotinylated, Mutant Form Of The E2f Double Stranded Dna Binding Site (E2fmut: Biotin 59gatctagttttcgatattaaatttga 39), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39)/product/Promega
Average 90 stars, based on 1 article reviews
59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
BIOSYNTAN gmbh biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form)
Biotinylated Peptide, Biotin Aminohexyl Aeeeeyfelvakkk (C Terminal In Amide Form), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form)/product/BIOSYNTAN gmbh
Average 90 stars, based on 1 article reviews
biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
BIOSYNTAN gmbh biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide)
Biotinylated Peptide Biotin Alklvrtpsfvitak (C Terminus In Amid Form, “Chk1 Tide), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide)/product/BIOSYNTAN gmbh
Average 90 stars, based on 1 article reviews
biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
BIOSYNTAN gmbh c terminally biotinylated form of l-glucagon
C Terminally Biotinylated Form Of L Glucagon, supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c terminally biotinylated form of l-glucagon/product/BIOSYNTAN gmbh
Average 90 stars, based on 1 article reviews
c terminally biotinylated form of l-glucagon - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Becton Dickinson biotinylated form diluted 1:250
Biotinylated Form Diluted 1:250, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated form diluted 1:250/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
biotinylated form diluted 1:250 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Kamiya 120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk)
120 M Cell Permeable Biotinylated Form Of The General Caspase Inhibitor Vad Fmk (B Vad Fmk), supplied by Kamiya, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk)/product/Kamiya
Average 90 stars, based on 1 article reviews
120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Biomatik biotinylated form of substrate peptides
Biotinylated Form Of Substrate Peptides, supplied by Biomatik, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated form of substrate peptides/product/Biomatik
Average 90 stars, based on 1 article reviews
biotinylated form of substrate peptides - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Form Bio Inc biotinylated form
Biotinylated Form, supplied by Form Bio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated form/product/Form Bio Inc
Average 90 stars, based on 1 article reviews
biotinylated form - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Becton Dickinson biotinylated form of the catalytic domain of matriptase (1 μg/ml)
Biotinylated Form Of The Catalytic Domain Of Matriptase (1 μg/Ml), supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated form of the catalytic domain of matriptase (1 μg/ml)/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
biotinylated form of the catalytic domain of matriptase (1 μg/ml) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
GL Biochem n-terminal biotinylated form
N Terminal Biotinylated Form, supplied by GL Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n-terminal biotinylated form/product/GL Biochem
Average 90 stars, based on 1 article reviews
n-terminal biotinylated form - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
BIOSYNTAN gmbh biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form)
Biotinylated Peptide Biotin Peg2svepplsqetfsd (C Terminus In Amide Form), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form)/product/BIOSYNTAN gmbh
Average 90 stars, based on 1 article reviews
biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Cayman Chemical a biotinylated form of 13(s)-hode
A Biotinylated Form Of 13(S) Hode, supplied by Cayman Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a biotinylated form of 13(s)-hode/product/Cayman Chemical
Average 90 stars, based on 1 article reviews
a biotinylated form of 13(s)-hode - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results