90
|
Promega
59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39) 59 Biotinylated, Mutant Form Of The E2f Double Stranded Dna Binding Site (E2fmut: Biotin 59gatctagttttcgatattaaatttga 39), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39)/product/Promega Average 90 stars, based on 1 article reviews
59-biotinylated, mutant form of the e2f double-stranded dna binding site (e2fmut: biotin-59gatctagttttcgatattaaatttga-39) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
BIOSYNTAN gmbh
biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form) Biotinylated Peptide, Biotin Aminohexyl Aeeeeyfelvakkk (C Terminal In Amide Form), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form)/product/BIOSYNTAN gmbh Average 90 stars, based on 1 article reviews
biotinylated peptide, biotin-aminohexyl-aeeeeyfelvakkk (c-terminal in amide form) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
BIOSYNTAN gmbh
biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide) Biotinylated Peptide Biotin Alklvrtpsfvitak (C Terminus In Amid Form, “Chk1 Tide), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide)/product/BIOSYNTAN gmbh Average 90 stars, based on 1 article reviews
biotinylated peptide biotin-alklvrtpsfvitak (c-terminus in amid form, “chk1-tide) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
BIOSYNTAN gmbh
c terminally biotinylated form of l-glucagon C Terminally Biotinylated Form Of L Glucagon, supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c terminally biotinylated form of l-glucagon/product/BIOSYNTAN gmbh Average 90 stars, based on 1 article reviews
c terminally biotinylated form of l-glucagon - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
biotinylated form diluted 1:250 Biotinylated Form Diluted 1:250, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated form diluted 1:250/product/Becton Dickinson Average 90 stars, based on 1 article reviews
biotinylated form diluted 1:250 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Kamiya
120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk) 120 M Cell Permeable Biotinylated Form Of The General Caspase Inhibitor Vad Fmk (B Vad Fmk), supplied by Kamiya, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk)/product/Kamiya Average 90 stars, based on 1 article reviews
120 m cell-permeable biotinylated form of the general caspase inhibitor vad-fmk (b-vad-fmk) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Biomatik
biotinylated form of substrate peptides Biotinylated Form Of Substrate Peptides, supplied by Biomatik, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated form of substrate peptides/product/Biomatik Average 90 stars, based on 1 article reviews
biotinylated form of substrate peptides - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Form Bio Inc
biotinylated form Biotinylated Form, supplied by Form Bio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated form/product/Form Bio Inc Average 90 stars, based on 1 article reviews
biotinylated form - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
biotinylated form of the catalytic domain of matriptase (1 μg/ml) Biotinylated Form Of The Catalytic Domain Of Matriptase (1 μg/Ml), supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated form of the catalytic domain of matriptase (1 μg/ml)/product/Becton Dickinson Average 90 stars, based on 1 article reviews
biotinylated form of the catalytic domain of matriptase (1 μg/ml) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
GL Biochem
n-terminal biotinylated form N Terminal Biotinylated Form, supplied by GL Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n-terminal biotinylated form/product/GL Biochem Average 90 stars, based on 1 article reviews
n-terminal biotinylated form - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
BIOSYNTAN gmbh
biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form) Biotinylated Peptide Biotin Peg2svepplsqetfsd (C Terminus In Amide Form), supplied by BIOSYNTAN gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form)/product/BIOSYNTAN gmbh Average 90 stars, based on 1 article reviews
biotinylated peptide biotin-peg2svepplsqetfsd (c-terminus in amide form) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
90
|
Cayman Chemical
a biotinylated form of 13(s)-hode A Biotinylated Form Of 13(S) Hode, supplied by Cayman Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a biotinylated form of 13(s)-hode/product/Cayman Chemical Average 90 stars, based on 1 article reviews
a biotinylated form of 13(s)-hode - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |